A dead-simple web API for LANL's HIV sequence locator providing results in JSON. Positioning, region, and protein information is all available. Most of the data presented in the human-readable HTML page is extracted via this API. Get in touch if you need something that's missing!
POST .../within/hiv
Requires one or more values for the POST parameter
sequence
or a single-valued
fasta
parameter as a URL-encoded string or
file upload of FASTA-formatted
sequences.
Both protein and nucleotide sequences are accepted, although the data returned varies by type due to what LANL returns. See the curl example which queries a protein sequence and the same sequence as nucleotides. If you use LANL's tool directly, the reverse complements of your sequences will also be attempted and the best matching picked; in the interests of reliability and consistency, this API tells LANL not to reverse complement sequences. You should instead take care of this before submitting.
Optionally accepts a (highly recommended) base
parameter set to nucleotide
or amino
acid
which forces all sequences to be interpreted as
the given base type. This is necessary when submitting
sequences with an ambiguous base type due to the overlap in
IUPAC alphabets. In such cases, LANL seems to assume
nucleotides, potentially producing incorrect results. For
example, the amino acid sequence MGGDMKDNW
is
also a valid nucleotide sequence, albeit one many ambiguous
bases. Interpreting it as nucleotides, however, is
incorrect. It is not uncommon for short amino acid
peptides to exhibit this property.
On success (HTTP 200) the response body is a JSON array of objects, one per sequence. Both HTTP 4xx and 5xx status codes are used on failure with plain text bodies containing an error message.
The format
parameter may be set to
csv
to return comma-separated values partially
representating the full results. format
may
also be explicitly set to json
, though there is
no need to as JSON is the default and will remain so.
HTTP Status | Reason |
---|---|
405 Method Not Allowed | The request did not use the HTTP POST method |
415 Unsupported Media Type | The provided fasta parameter appears to be in the wrong format |
422 Unprocessable Entity | No sequence or fasta parameter was provided, or the parameter did not contain any sequences |
503 Service Unavailable | An unexpected condition occurred while parsing results from LANL |
500 Internal Server Error | An unexpected error occurred while processing your request |
The API tries not to return incorrect data from misparses of LANL's output. If it detects an anomoly in any of its parsing stages, it will abort the request and return an HTTP 503 Service Unavailable. If this happens to your request, or if you are receiving results you don't expect, please let us know!
Submit sequences as a FASTA file and download the location results as a CSV file. Note that the CSV does not contain all of the information the API can provide since CSV does not have standard support for nested or multi-valued data structures. This form uses the API described above.
Created by Thomas Sibley of the Mullins Lab at the University of Washington, Department of Microbiology.
Questions? Drop us a line.
curl -X POST http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv \ --data sequence=SLYNTVAVLYYVHQR \ --data sequence=TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG
[ { "query" : "sequence_1", "query_sequence" : "SLYNTVAVLYYVHQR", "base_type" : "amino acid", "reverse_complement" : "0", "alignment" : "\n Query SLYNTVAVLY YVHQR 15\n :::::::.:: :::: \n HXB2 SLYNTVATLY CVHQR\n\n ", "hxb2_sequence" : "SLYNTVATLYCVHQR", "similarity_to_hxb2" : "86.7", "start" : "77", "end" : "91", "genome_start" : "1018", "genome_end" : "1062", "polyprotein" : "Gag", "region_names" : [ "Gag", "p17" ], "regions" : [ { "cds" : "Gag", "aa_from_cds_start" : [ "229", "273" ], "aa_from_polyprotein_start" : null, "aa_from_protein_start" : [ "77", "91" ], "aa_from_query_start" : [ "1", "15" ], "na_from_hxb2_start" : [ "1018", "1062" ] }, { "cds" : "p17", "aa_from_cds_start" : [ "229", "273" ], "aa_from_polyprotein_start" : null, "aa_from_protein_start" : [ "77", "91" ], "aa_from_query_start" : [ "1", "15" ], "na_from_hxb2_start" : [ "1018", "1062" ] } ] }, { "query" : "sequence_2", "query_sequence" : "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG", "base_type" : "nucleotide", "reverse_complement" : "0", "alignment" : "\n Query TCATTATATA ATACAGTAGC AACCCTCTAT TGTGTGCATC AAAGG 45\n :::::::::: :::::::::: :::::::::: :::::::::: ::::: \n HXB2 TCATTATATA ATACAGTAGC AACCCTCTAT TGTGTGCATC AAAGG 1062\n\n ", "hxb2_sequence" : "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG", "similarity_to_hxb2" : "100.0", "start" : "229", "end" : "273", "genome_start" : "1018", "genome_end" : "1062", "polyprotein" : "Gag", "region_names" : [ "Gag", "p17" ], "regions" : [ { "cds" : "Gag", "aa_from_protein_start" : [ "77", "91" ], "na_from_cds_start" : [ "229", "273" ], "na_from_hxb2_start" : [ "1018", "1062" ], "na_from_query_start" : [ "1", "45" ], "protein_translation" : "SLYNTVATLYCVHQR" }, { "cds" : "p17", "aa_from_protein_start" : [ "77", "91" ], "na_from_cds_start" : [ "229", "273" ], "na_from_hxb2_start" : [ "1018", "1062" ], "na_from_query_start" : [ "1", "45" ], "protein_translation" : "SLYNTVATLYCVHQR" } ] } ]
curl -X POST http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv \ --data base='amino acid' \ --data sequence=MGGDMKDNW
curl -X POST http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv \ --form base=nucleotide \ --form fasta=@/path/to/your/input.fa
Bio::WebService::LANL::SequenceLocator
#!/usr/bin/env perl # # First install the library: # cpan -i Bio::WebService::LANL::SequenceLocator # use strict; use warnings; use Bio::WebService::LANL::SequenceLocator; my $locator = Bio::WebService::LANL::SequenceLocator->new( agent_string => 'Your Organization - you@example.com', ); my @sequences = $locator->find([ "agcaatcagatggtcagccaaaattgccctatagtgcagaacatcc" ."aggggcaagtggtacatcaggccatatcacctagaactttaaatgca", ]);
#!/usr/bin/env perl use strict; use warnings; use JSON qw< decode_json >; use LWP::UserAgent; my $agent = LWP::UserAgent->new( agent => 'you@example.com' ); my $response = $agent->post( "http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv" => [ sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG", ], ); unless ($response->is_success) { die "Request failed: ", $response->status_line, "\n", $response->decoded_content; } my $results = decode_json( $response->decoded_content ); # $results is now an array ref, like the JSON above print $results->[0]{polyprotein}, "\n";
#!/usr/bin/env python2 from urllib2 import Request, urlopen, URLError from urllib import urlencode import json request = Request('http://indra.microbiol.washington.edu/locate-sequence/within/hiv') data = urlencode({ 'sequence': [ 'SLYNTVAVLYYVHQR', 'TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG' ] }, True); try: response = urlopen(request, data) text = response.read() results = json.loads(text) except URLError, e: print 'Request failed: ', e except ValueError, e: print 'Decoding JSON failed: ', e finally: if results == None: exit(1) print results
library("RCurl") library("rjson") results = tryCatch( fromJSON( postForm( "http://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv", sequence="SLYNTVAVLYYVHQR", sequence="TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG")), HTTPError = function(e) cat("Error making request: ", e$message), error = function(e) cat("Error decoding JSON")) print(lapply(results, function(s) s$genome_start))